Skip to main content

Advertisement

Table 1 Primers used in each reaction combination

From: Assessing meiofaunal variation among individuals utilising morphological and molecular approaches: an example using the Tardigrada

   Forward Reverse
18S    
Amp 1   SSU01_F SSU82_R_short
   AACCTGGTTGATCCTGCCAGT TGATCCTTCTGCAGGTTCACC
Amp 2    
  Fragment 1 SSU01_F SSU26_R
   AACCTGGTTGATCCTGCCAGT CATTCTTGGCAAATGCTTTCG
  Fragment 2 SSU22_F SSU13_R
   TCCAAGGAAGGCAGCAGGC GGGCATCACAGACCTGTTA
  Fragment 3 SSU26_F SSU82_R
   CGAAAGCATTTGCCAAGAATG TGATCCTTCTGCAGGTTCACCTAC
CO1    
Amp 1   LCO_1490 mtD9_2206
   GGTCAACAAATCATAAAGATATTGG CCCGGTAAAATTAAAATATAAACTTC
Amp 2   LCO_1490 HCO_2198
   GGTCAACAAATCATAAAGATATTGG TAAACTTCAGGGTGACCAAAAAATCA
Wingless    
Amp 1   Wg1s_F Wg2n_R
   GARTGYAARTGYCAYGG ACYTCRCARCACCARTG
Amp 2   Wg1a_F Wgs_R
   GARTGYAARTGYCAYGGYATGTCTGG ACYTCRCARCACCARTGRAA
Alpha Spectrin    
Amp 1   Aspec11_F Aspec15_R
   TGGATHMGNGARAARGA AARTCRTCRAAYTTYTTYTG
Amp 2   Aspec11_F Aspec12_R
   TGGATHMGNGARAARGA ACYTCNACYTTCCACCARTC
Elongation Factor 1alpha    
Amp 1   237_F 1450_R
   CGGYCAYTTGATCTACAAATGC TGTCRCGCACAGCGAAACKACC
Amp 2   277_F 1221L_R
   ACSATYGAGAAGTTCGAGAAG GGRTGRTTMARIACRATMACCTG
  1. Each sequence corresponds to one of two oligo-nucleotide primers used for each specific reaction. In addition, all forward primers were tailed with M13_REV (CAGGAAACAGCTATGACC) and all reverse primers were tailed with M13 – 21 (TGTAAAACGACGGCCAGT). Primers for 18S were adapted from [55]. LCO/HCO primers for CO1 were designed by [56]. mtD9 was designed by [57]. Wingless and Alpha Spectrin primers were sourced from [58]. Elongation Factor 1 alpha primers were designed from GenBank alignments of onychophora, tardigrade, drosophila and artemia.